Second strand direct

Patent metadata

Field	Value
Publication number	US-10876112-B2
Application number	US-201916687411-A
Country	US
Kind code	B2
Filing date	Nov 18, 2019
Priority date	Aug 5, 2016
Publication date	Dec 29, 2020
Grant date	Dec 29, 2020

Abstract

Methods and compositions are provided herein for preparing high-throughput cDNA sequencing libraries.

First claim

What is claimed is:

1. A method of sequencing a sequencing platform specific cDNA amplicon comprising:
providing the sequencing platform specific amplicon, wherein the sequencing platform specific amplicon comprises a double-stranded polynucleotide comprising:
i) a first end comprising SEQ ID NO:1;
ii) a second end comprising SEQ ID NO:2; and
iii) a middle region comprising a double-stranded cDNA polynucleotide comprising a first strand cDNA polynucleotide complementary to an mRNA sequence hybridized to a second strand cDNA polynucleotide that corresponds to the mRNA sequence; and

sequencing the amplicon from the second end with a second sequencing primer comprising SEQ ID NO:8.

2. The method of claim 1 , wherein the first end comprises a 3′ poly-A region of the second strand cDNA polynucleotide that corresponds to a 3′ polyadenylation region of the mRNA sequence.

3. The method of claim 2 , wherein the second strand cDNA polynucleotide has a length that is less than 90% of the length of a corresponding mRNA.

4. The method of claim 1 , wherein the method comprises sequencing the amplicon from the first end with a first sequencing primer and then sequencing the amplicon from the second end with the second sequencing primer.

5. The method of claim 4 , wherein the first sequencing primer comprises the sequence from 5′ to 3′ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC (SEQ ID NO:9) or from 5′ to 3′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:12).

6. The method of claim 1 , wherein the second sequencing primer comprises from 5′ to 3′ AGATGTGTATAAGAGACAG (SEQ ID NO:10).

7. The method of claim 1 , wherein the second sequencing primer comprises from 5′ to 3′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO:11).

8. A method of sequencing a plurality of sequencing platform specific cDNA amplicons comprising:
providing the plurality of sequencing platform specific amplicons, wherein the individual sequencing platform specific amplicons comprise a double-stranded polynucleotide comprising:
i) a first end comprising SEQ ID NO:1;
ii) a second end comprising SEQ ID NO:2; and
iii) a middle region comprising a double-stranded cDNA polynucleotide comprising a first strand cDNA polynucleotide complementary to an mRNA sequence hybridized to a second strand cDNA polynucleotide that corresponds to the mRNA sequence;

sequencing a portion of the amplicons from the second end with a second sequencing primer comprising SEQ ID NO:8; and
sequencing a portion of the amplicons from the second end with a third sequencing primer comprising from 5′ to 3′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO:12).

9. The method of claim 8 , wherein the second sequencing primer comprises SEQ ID NO:11.

Assignees

• Bio Rad Laboratories
• Bio Rad Europe Gmbh

Inventors

• Lebofsky Ronald
• Agresti Jeremy

Classifications

• C12Q1/6869 Primary

  Methods for sequencing · CPC title

• C12Q1/6844

  Nucleic acid amplification reactions · CPC title

• C12N15/1096 Primary

  cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR · CPC title

• C12N15/1065

  Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags · CPC title

• C12Q1/6806

  Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay (C12Q1/6804 takes precedence) · CPC title