Increasing specificity for RNA-guided genome editing

US10844403B2 · US · B2

Patent metadata
FieldValue
Publication numberUS-10844403-B2
Application numberUS-201815870659-A
CountryUS
Kind codeB2
Filing dateJan 12, 2018
Priority dateMar 15, 2013
Publication dateNov 24, 2020
Grant dateNov 24, 2020

How to read this patent

A practical reading order for non-experts. Skip the full description unless you need deep technical detail.

  1. Title

    What the patent document calls the invention.

  2. Abstract

    A short plain-language summary of the technical disclosure.

  3. Assignees and inventors

    Who owns or filed the patent and who is credited as inventor.

  4. Key dates

    Filing, priority, publication, and grant dates set the timeline.

  5. First independent claim

    The legal scope of protection — read this for what is actually claimed.

  6. CPC / IPC classifications

    Technology tags used to group this patent with similar filings.

  7. Citations and related patents

    Prior art links and similar publications in this corpus.

Abstract

Official abstract text for this publication.

Methods for increasing specificity of RNA-guided genome editing, e.g., editing using CRISPR/Cas9 systems.

First claim

Opening claim text (preview).

What is claimed is: 1. A hybrid guide nucleic acid consisting of the sequence: (SEQ ID NO: 4) (X 17-20 )GUUUUAGAGCUAUGCUGUUUUG(X N ); (SEQ ID NO: 5) (X 17-20 )GUUUUAGAGCUA; (SEQ ID NO: 6) (X 17-20 )GUUUUAGAGCUAUGCUGUUUUG; (SEQ ID NO: 7) (X 17-20 )GUUUUAGAGCUAUGCU; (SEQ ID NO: 8) (X 17-20 )GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCG(X N ); (SEQ ID NO: 9) (X 17-20 )GUUUUAGAGCUAUGCUGAAAAGCAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUC(X N ); (SEQ ID NO: 10) (X 17-20 )GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCAUA GCAAGUUAAAAUAAGGCUAGUCCGUUAUC(X N ); (SEQ ID NO: 11) (X 17-20 )GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC(X N ); (SEQ ID NO: 12) (X 17-20 )GUUUAAGAGCUAGAAAUAGCAAGUUUAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC; (SEQ ID NO: 13) (X 17-20 )GUUUUAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAA AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGC; and (SEQ ID NO: 14) (X 17-20 )GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAA AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGC, wherein the X 17-20 is a sequence complementary to 17-20 consecutive nucleotides of the complementary strand of a target sequence, preferably a target sequence immediately 5′ of a protospacer adjacent motif (PAM), wherein one or more of the nucleotides is a deoxyribonucleic acid, and N is 0-50. 2. A vector comprising the DNA molecule of claim 1 . 3. A host cell expressing the hybrid guide nucleic acid of claim 1 . 4. The hybrid guide nucleic acid of claim 1 , wherein the one or more deoxyribonucleotides are within the sequence complementary to 17-20 consecutive nucleotides of the complementary strand of the target sequence. 5. The hybrid guide nucleic acid of claim 1 , wherein the one or more deoxyribonucleotides comprise thymine in place of uracil. 6. The hybrid guide nucleic acid of claim 1 , wherein the X 17 -20 is at least partially or wholly DNA. 7. A composition comprising: a nucleic acid encoding a variant S. pyogenes Cas 9 protein comprising an amino acid sequence that has at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 18 with mutations at D10, E762, H983, D986, H840 or N863; and a nucleic acid encoding a hybrid guide nucleic acid that directs the variant S. pyogenes Cas9 protein to a target sequence; wherein the hybrid guide nucleic acid is selected from the group consisting of: (X 17 -20) GUUUUAGAGCUAUGCUGUUUUG(XN) (SEQ ID NO:4); (X 17 -20) GUUUUAGAGCUA (SEQ ID NO:5); (X 17 -20) GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO:6); (X 17 -20) GUUUUAGAGCUAUGCU (SEQ ID NO:7); (X 17 -20) GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(XN) (SEQ ID NO:8); (X 17 -20) GUUUUAGAGCUAUGCUGAAAAGCAUAGCAAGUUAAAAUAAGGCUA GUCCGUUAUC(XN) (SEQ ID NO:9); (X 17 -20) GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUC(XN) (SEQ ID NO:10); (X 17 -2o)GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUA UCAACUUGAAAAAGUGGCACCGAGUCGGUGC(XN) (SEQ ID NO:11); (X 17 -2o)GUUUAAGAGCUAGAAAUAGCAAGUUUAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGGCACCGAGUCGGUGC(SEQ ID NO:12); (X 17 -2o)GUUUUAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:13); and (X 17 -2o)GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGC UAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:14), wherein the X 17 -20 is a sequence complementary to 17-20 consecutive nucleotides of the complementary strand of a target sequence, preferably a target sequence immediately 5′ of a protospacer adjacent motif (PAM), wherein one or more of the nucleotides is a deoxyribonucleic acid, and N is 0-50. 8. The composition of claim 7 , wherein the one or more deoxyribonucleotides are within the sequence complementary to 17-20 consecutive nucleotides of the complementary strand of the target sequence. 9. The composition of claim 7 , wherein the one or more deoxyribonucleotides comprise thymine in place of uracil. 10. The composition of claim 7 , wherein the X 17 -20 is at least partially or wholly DNA. 11. The composition of claim 7 , wherein the variant S. pyogenes Cas 9 comprises a mutation at positions D10 and H840. 12. The composition of claim 11 , wherein the mutation at position D10 is D10A or D10N, and the mutation at position H840 is H840A, H840N or H840Y. 13. The composition of claim 7 , wherein the variant S. pyogenes Cas 9 protein is fused to a heterologous

Assignees

Inventors

Classifications

  • Hydrolases acting on ester bonds (3.1) · CPC title

  • Methyltransferases (2.1.1) · CPC title

  • involving clustered regularly interspaced short palindromic repeats [CRISPR] · CPC title

  • C12N15/113Primary

    Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title

  • Mutagenizing nucleic acids · CPC title

Patent family

Related publications grouped by family.

External sources

Frequently asked questions

Answers are generated from the same data shown on this page.

What does patent US10844403B2 cover?
Methods for increasing specificity of RNA-guided genome editing, e.g., editing using CRISPR/Cas9 systems.
Who is the assignee on this patent?
Massachusetts Gen Hospital
What technology area does this patent fall under?
Primary CPC classification C12N15/113. Mapped technology areas include Chemistry & Metallurgy.
When was this patent published?
Publication date Tue Nov 24 2020 00:00:00 GMT+0000 (Coordinated Universal Time) (B2). Legal status and post-grant events are not shown on this page.
What related patents are in patentsdb?
We list 12 related publications on this page (citations in our corpus or others sharing the same primary CPC).