Compositions and methods for the treatment of hemoglobinopathies
US-2015166969-A1 · Jun 18, 2015 · US
US10844403B2 · US · B2
| Field | Value |
|---|---|
| Publication number | US-10844403-B2 |
| Application number | US-201815870659-A |
| Country | US |
| Kind code | B2 |
| Filing date | Jan 12, 2018 |
| Priority date | Mar 15, 2013 |
| Publication date | Nov 24, 2020 |
| Grant date | Nov 24, 2020 |
A practical reading order for non-experts. Skip the full description unless you need deep technical detail.
What the patent document calls the invention.
A short plain-language summary of the technical disclosure.
Who owns or filed the patent and who is credited as inventor.
Filing, priority, publication, and grant dates set the timeline.
The legal scope of protection — read this for what is actually claimed.
Technology tags used to group this patent with similar filings.
Prior art links and similar publications in this corpus.
Official abstract text for this publication.
Methods for increasing specificity of RNA-guided genome editing, e.g., editing using CRISPR/Cas9 systems.
Opening claim text (preview).
What is claimed is: 1. A hybrid guide nucleic acid consisting of the sequence: (SEQ ID NO: 4) (X 17-20 )GUUUUAGAGCUAUGCUGUUUUG(X N ); (SEQ ID NO: 5) (X 17-20 )GUUUUAGAGCUA; (SEQ ID NO: 6) (X 17-20 )GUUUUAGAGCUAUGCUGUUUUG; (SEQ ID NO: 7) (X 17-20 )GUUUUAGAGCUAUGCU; (SEQ ID NO: 8) (X 17-20 )GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCG(X N ); (SEQ ID NO: 9) (X 17-20 )GUUUUAGAGCUAUGCUGAAAAGCAUAGCAAGUUAAAAU AAGGCUAGUCCGUUAUC(X N ); (SEQ ID NO: 10) (X 17-20 )GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCAUA GCAAGUUAAAAUAAGGCUAGUCCGUUAUC(X N ); (SEQ ID NO: 11) (X 17-20 )GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC(X N ); (SEQ ID NO: 12) (X 17-20 )GUUUAAGAGCUAGAAAUAGCAAGUUUAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC; (SEQ ID NO: 13) (X 17-20 )GUUUUAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAA AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGC; and (SEQ ID NO: 14) (X 17-20 )GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAA AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGC, wherein the X 17-20 is a sequence complementary to 17-20 consecutive nucleotides of the complementary strand of a target sequence, preferably a target sequence immediately 5′ of a protospacer adjacent motif (PAM), wherein one or more of the nucleotides is a deoxyribonucleic acid, and N is 0-50. 2. A vector comprising the DNA molecule of claim 1 . 3. A host cell expressing the hybrid guide nucleic acid of claim 1 . 4. The hybrid guide nucleic acid of claim 1 , wherein the one or more deoxyribonucleotides are within the sequence complementary to 17-20 consecutive nucleotides of the complementary strand of the target sequence. 5. The hybrid guide nucleic acid of claim 1 , wherein the one or more deoxyribonucleotides comprise thymine in place of uracil. 6. The hybrid guide nucleic acid of claim 1 , wherein the X 17 -20 is at least partially or wholly DNA. 7. A composition comprising: a nucleic acid encoding a variant S. pyogenes Cas 9 protein comprising an amino acid sequence that has at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 18 with mutations at D10, E762, H983, D986, H840 or N863; and a nucleic acid encoding a hybrid guide nucleic acid that directs the variant S. pyogenes Cas9 protein to a target sequence; wherein the hybrid guide nucleic acid is selected from the group consisting of: (X 17 -20) GUUUUAGAGCUAUGCUGUUUUG(XN) (SEQ ID NO:4); (X 17 -20) GUUUUAGAGCUA (SEQ ID NO:5); (X 17 -20) GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO:6); (X 17 -20) GUUUUAGAGCUAUGCU (SEQ ID NO:7); (X 17 -20) GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCG(XN) (SEQ ID NO:8); (X 17 -20) GUUUUAGAGCUAUGCUGAAAAGCAUAGCAAGUUAAAAUAAGGCUA GUCCGUUAUC(XN) (SEQ ID NO:9); (X 17 -20) GUUUUAGAGCUAUGCUGUUUUGGAAACAAAACAGCAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUC(XN) (SEQ ID NO:10); (X 17 -2o)GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUA UCAACUUGAAAAAGUGGCACCGAGUCGGUGC(XN) (SEQ ID NO:11); (X 17 -2o)GUUUAAGAGCUAGAAAUAGCAAGUUUAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGGCACCGAGUCGGUGC(SEQ ID NO:12); (X 17 -2o)GUUUUAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:13); and (X 17 -2o)GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGC UAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:14), wherein the X 17 -20 is a sequence complementary to 17-20 consecutive nucleotides of the complementary strand of a target sequence, preferably a target sequence immediately 5′ of a protospacer adjacent motif (PAM), wherein one or more of the nucleotides is a deoxyribonucleic acid, and N is 0-50. 8. The composition of claim 7 , wherein the one or more deoxyribonucleotides are within the sequence complementary to 17-20 consecutive nucleotides of the complementary strand of the target sequence. 9. The composition of claim 7 , wherein the one or more deoxyribonucleotides comprise thymine in place of uracil. 10. The composition of claim 7 , wherein the X 17 -20 is at least partially or wholly DNA. 11. The composition of claim 7 , wherein the variant S. pyogenes Cas 9 comprises a mutation at positions D10 and H840. 12. The composition of claim 11 , wherein the mutation at position D10 is D10A or D10N, and the mutation at position H840 is H840A, H840N or H840Y. 13. The composition of claim 7 , wherein the variant S. pyogenes Cas 9 protein is fused to a heterologous
Hydrolases acting on ester bonds (3.1) · CPC title
Methyltransferases (2.1.1) · CPC title
involving clustered regularly interspaced short palindromic repeats [CRISPR] · CPC title
Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title
Mutagenizing nucleic acids · CPC title
Related publications grouped by family.
Answers are generated from the same data shown on this page.