Amino acid-modified nucleic acid and utilization thereof

Patent metadata

Field	Value
Publication number	US-10711273-B2
Application number	US-201615579841-A
Country	US
Kind code	B2
Filing date	Jun 8, 2016
Priority date	Jun 9, 2015
Publication date	Jul 14, 2020
Grant date	Jul 14, 2020

Abstract

Provided is a method for synthesizing a protein, into which a nucleobase amino acid (NBA) is introduced at a desired position, that comprises: a step for preparing mRNA into which a modified codon is inserted at a desired position downstream of an initiation codon; and a step for translating the aforesaid mRNA into a protein in the presence of tRNA, said tRNA recognizing the modified codon and being acylated with the NBA. Also provided is a ribozyme that catalyzes the aminoacylation of tRNA and comprises two RNA molecules.

First claim

The invention claimed is:

1. A method for synthesizing a protein, comprising the steps of:
providing an mRNA having a modified codon inserted at a desired position downstream of a start codon; and
translating the mRNA into a protein in the presence of a tRNA acylated with a nucleobase amino acid (NBA) and recognizing the modified codon, wherein the NBA is an amino acid having a nucleobase as a side chain thereof, the nucleobase is selected from the group consisting of thymine (T), uracil (U), and derivatives thereof.

2. The method according to claim 1 , further comprising the step of preparing the tRNA acylated with the NBA with a ribozyme that catalyzes the aminoacylation reaction of the tRNA.

3. The method according to claim 2 , wherein the ribozyme is a flexizyme consisting of the nucleotide sequence of SEQ ID NO:1.

4. The method according to claim 2 , wherein the ribozyme consists of one or more RNA molecules having no 5′-terminal phosphate group.

5. The method according to claim 2 , wherein the ribozyme consists of two RNA molecules.

6. The method according to claim 5 , wherein the ribozyme consists of the following two RNA molecules:

(1)

(SEQ ID NO: 4)

GGAUCGAAAGAUUUCCGCGGCCCCG

and

(2)

(SEQ ID NO: 5)

CGGGGAUUAGCGUUAGGU.

7. The method according to claim 1 , wherein the modified codon is an amber codon.

8. A cell-free protein synthesis system for synthesizing a protein, comprising:
(1) a nucleobase amino acid (NBA), wherein the NBA is an amino acid having a nucleobase as a side chain thereof, the nucleobase is selected from the group consisting of thymine (T), uracil (U), and derivatives thereof,
(2) a tRNA that recognizes a modified codon, and
(3) a ribozyme that catalyzes the aminoacylation reaction of the tRNA.

9. The cell-free protein synthesis system according to claim 8 , wherein the ribozyme is a flexizyme consisting of the nucleotide sequence of SEQ ID NO:1.

10. The cell-free protein synthesis system according to claim 8 , wherein the ribozyme consists of one or more RNA molecules having no 5′-terminal phosphate group.

11. The cell-free protein synthesis system according to claim 8 , wherein the ribozyme consists of two RNA molecules.

12. The cell-free protein synthesis system according to claim 11 , wherein the two RNA molecules are

(1)

(SEQ ID NO: 4)

GGAUCGAAAGAUUUCCGCGGCCCCG

and

(2)

(SEQ ID NO: 5)

CGGGGAUUAGCGUUAGGU.

13. The cell-free protein synthesis system according to claim 8 , wherein the modified codon is an amber codon.

Assignees

• Aist

Inventors

• Kato Yoshio
• Kojima Naoshi

Classifications

• C12P21/02

  having a known sequence of two or more amino acids, e.g. glutathione · CPC title

• C12N2310/12

  catalytic nucleic acids, e.g. ribozymes · CPC title

• C07K2319/60

  containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP] · CPC title

• C07K2319/50

  containing protease site · CPC title

• C12N15/11 Primary

  DNA or RNA fragments; Modified forms thereof (DNA or RNA not used in recombinant technology, C07H21/00); {Non-coding nucleic acids having a biological activity} · CPC title