Compositions and methods for inhibition of lineage specific antigens

Patent metadata

Field	Value
Publication number	US-10668103-B2
Application number	US-201916451934-A
Country	US
Kind code	B2
Filing date	Jun 25, 2019
Priority date	Oct 16, 2015
Publication date	Jun 2, 2020
Grant date	Jun 2, 2020

Abstract

Disclosed herein are methods of administering an agent targeting a lineage-specific cell-surface antigen and a population of hematopoietic cells that are deficient in the lineage-specific cell-surface antigen for immunotherapy of hematological malignancies.

First claim

What is claimed is:

1. A method of treating acute myeloid leukemia (AML) in a subject in need thereof, the method comprising:
(a) administering to the subject a CD33-targeted therapy comprising a CD33 CAR-T cell; and
(b) administering to the subject a population of modified hematopoietic stem and progenitor cells (HSPCs) that have reduced or eliminated expression of CD33,
wherein the HSPCs comprise an insertion and/or deletion in an endogenous CD33 coding sequence that was introduced by a CRISPR system comprising a guide nucleic acid,
wherein the endogenous CD33 coding sequence encodes a CD33 protein that localizes to a cell surface, and
wherein the insertion and/or deletion is capable of downregulating gene expression of CD33.

2. The method of claim 1 , wherein the CRISPR system further comprises an exogenous template polynucleotide for homologous recombination (HR)-mediated repair.

3. The method of claim 1 , wherein the guide nucleic acid of the CRISPR system is a single guide RNA (gRNA).

4. The method of claim 3 , wherein the single gRNA comprises a sequence selected from the group consisting of ACCTGTCAGGTGAAGTTCGCTGG (SEQ ID NO: 11), CACCGAGGAGTGAGTAGTCCTGG (SEQ ID NO: 30), TGGCCGGGTTCTAGAGTGCCAGG (SEQ ID NO: 28), TCCAGCGAACTTCACCTGACAGG (SEQ ID NO: 31), GGCCGGGTTCTAGAGTGCCAGGG (SEQ ID NO: 29) and complements thereof.

5. The method of claim 1 , wherein the HSPCs are administered to the subject by infusion before the CD33-targeted therapy is administered to the subject.

6. The method of claim 1 , wherein the HSPCs are autologous to the subject and obtained from a source selected from the group consisting of peripheral blood mononuclear cells, bone marrow, lymph node, and spleen.

7. The method of claim 1 , wherein the HSPCs are CD34+ HSPCs.

Assignees

• Univ Columbia

Inventors

• Mukherjee Siddhartha
• Borot Florence
• Ali Abdullah Mahmood

Classifications

• C07K16/2803 Primary

  against the immunoglobulin superfamily · CPC title

• C07K16/30

  from tumour cells · CPC title

• A61K2035/124

  the cells being hematopoietic, bone marrow derived or blood cells · CPC title

• A61K35/17

  Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes (when activated by a specific antigen A61K39/00) · CPC title

• A61K2039/505

  comprising antibodies · CPC title