Construction of MicroRNA gene-mediated novel tissue engineered nerve and applications thereof in repairing nerve defect

Patent metadata

Field	Value
Publication number	US-10639399-B2
Application number	US-201716089190-A
Country	US
Kind code	B2
Filing date	Apr 5, 2017
Priority date	Nov 21, 2016
Publication date	May 5, 2020
Grant date	May 5, 2020

Abstract

Provided is a use of one or more MicroRNA genes selected from miRNAs of Family Let-7, miR-21 or miR-222 in the construction of tissue engineered nerves and in the repair of peripheral nerve defects. An outer and/or internal surface or pores of a tissue engineered nerve graft are coated or adsorbed with polymeric nanomicrospheres carrying a Let-7 family miRNA inhibitor, miR-21, or miR-222, or a mimetic thereof, wherein the polymeric material is composed of biocompatible fibronectin and heparin. The regeneration of peripheral nerves and the construction of tissue engineered nerves are promoted by regulating the expression of MicroRNA genes which can effectively promote the proliferation of primary Schwann cells cultured in vitro and have an anti-apoptotic effect on neuronal cells. In-vivo test proves that bridging of the tissue engineered nerve graft can facilitate the regeneration of peripheral nerves, thus being useful in the treatment of peripheral nerve injury.

First claim

The invention claimed is:

1. A method for construction of a tissue engineered nerve or repair of peripheral nerve defects, comprising administering a Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof to a tissue engineered nerve graft.

2. The method according to claim 1 , further comprising: depositing the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof on an surface of the tissue engineered nerve graft, wherein the surface is an outer surface, an inter surface, a surface of a pore in the tissue engineered nerve graft, or a mixture thereof.

3. The method according to claim 2 , wherein the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof is present on the tissue engineered nerve graft material in an amount of 10 μg/g-10 mg/g.

4. The method according to claim 1 , further comprising embedding the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof in nanomicrospheres.

5. The method according to claim 4 , wherein the embedded nanomicrospheres are polymeric nanomicrospheres carrying the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof, and the polymeric material is composed of biocompatible fibronectin and heparin.

6. The method according to claim 5 , wherein the weight ratio of fibronectin to heparin is 1:10-1:1.

7. The method according to claim 1 , wherein the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof is:

SEQ ID No: 1;

rno-let-7a-5p: UGAGGUAGUAGGUUGUAUAGUU,

SEQ ID No: 2;

rno-let-7a-3p: CUAUACAAUCUACUGUCUUUCC,

SEQ ID No: 3;

rno-let-7b-5p: UGAGGUAGUAGGUUGUGUGGUU,

SEQ ID No: 4;

rno-let-7b-3p: CUAUACAACCUACUGCCUUCCC,

SEQ ID No: 5;

rno-let-7c-5p: UGAGGUAGUAGGUUGUAUGGUU,

SEQ ID No: 6;

rno-let-7c-3p: CUGUACAACCUUCUAGCUUUCC,

SEQ ID No: 7;

rno-let-7d-5p: AGAGGUAGUAGGUUGCAUAGUU,

SEQ ID No: 8;

rno-let-7d-3p: CUAUACGACCUGCUGCCUUUCU,

SEQ ID No: 9;

rno-miR-98-5p: UGAGGUAGUAAGUUGUAUUGUU,

SEQ ID No: 10;

rno-miR-98-3p: CUAUACAACUUACUACUUUCC,

SEQ ID No: 13;

rno-miR-222-5p: GGCUCAGUAGCCAGUGUAGAU,

and

SEQ ID No: 14;

rno-miR-222-3p: AGCUACAUCUGGCUACUGGGU.

8. A tissue engineered nerve graft, wherein a Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof is deposited on an surface of the tissue engineered nerve graft and the surface is an outer surface, an inter surface, a surface of a pore in the tissue engineered nerve graft, or a mixture thereof.

9. The tissue engineered nerve graft according to claim 8 , wherein:
the Let-7 family miRNA inhibitor, miR-222, or a mimetic thereof is embedded in nanomicrospheres;
the embedded nanomicrospheres are polymeric nanomicrospheres; and
the polymeric material is composed of biocompatible fibronectin and heparin.

Assignees

• Univ Nantong

Inventors

• Gu Xiaosong
• Ding Fei
• Tang Xin
• Yang Yumin
• Yu Bin
• Li Shiying
• Zhou Songlin
• Zhang Luzhong
• Wang Yaxian
• Gu Yun
• Sun Hualin

Classifications

• A61L27/24

  Collagen · CPC title

• C12N15/113 Primary

  Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; {Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing (when used in plants C12N15/8218)} · CPC title

• C12N2310/113

  targeting other non-coding nucleic acids, e.g. antagomirs · CPC title

• A61L27/54

  Biologically active materials, e.g. therapeutic substances {(A61L27/227 takes precedence)} · CPC title

• A61L27/22

  Polypeptides or derivatives thereof {, e.g. degradation products} · CPC title