Oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders

Patent metadata

Field	Value
Publication number	US-10519451-B2
Application number	US-201715814350-A
Country	US
Kind code	B2
Filing date	Nov 15, 2017
Priority date	Apr 3, 2015
Publication date	Dec 31, 2019
Grant date	Dec 31, 2019

Abstract

This disclosure relates to novel targets for angiogenic disorders. Novel oligonucleotides are also provided. Methods of using the novel oligonucleotides for the treatment of angiogenic disorders (e.g., preeclampsia) are also provided.

First claim

What is claimed:

1. A compound comprising an RNA molecule that is between 15 and 35 bases in length having a 5′ end, a 3′ end and complementarity to a target that binds to an intronic region of an mRNA encoding an sFLT1 protein, wherein the RNA molecule is fully chemically-stabilized and comprises a hydrophobic modification, wherein the compound selectively inhibits expression of the sFLT1 protein in a cell or organism.

2. The compound of claim 1 , comprising a single stranded (ss) RNA molecule or a double stranded (ds) RNA molecule.

3. The compound of claim 2 , comprising a dsRNA having a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity which is substantially complementary to

(SEQ ID NO: 1)

5′ CTCTCGGATCTCCAAATTTA 3′,

(SEQ ID NO: 2)

5′ CATCATAGCTACCATTTATT 3′,

(SEQ ID NO: 3)

5′ ATTGTACCACACAAAGTAAT 3′

or

(SEQ ID NO: 4)

5′ GAGCCAAGACAATCATAACA 3′,

or
contains no more than 3 mismatches with SEQ ID NO:1.

4. The dsRNA of claim 3 , wherein said region of complementarity
is complementary to at least 15 contiguous nucleotides of SEQ ID NO:1.

5. The dsRNA of claim 3 , wherein said dsRNA is blunt-ended.

6. The compound of claim 1 , wherein the fully chemically stabilized RNA molecule comprises at least one modified nucleotide selected from the group consisting of a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative, a 2′-deoxy -2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.

7. The dsRNA of claim 2 , said dsRNA having a 5′ end, a 3′ end and complementarity to a target, and comprising a first oligonucleotide and a second oligonucleotide, wherein:
(1) the first oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4;
(2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide; and
(3) the nucleotides of the second oligonucleotide are connected via phosphodiester or phosphorothioate linkages.

8. A therapeutic compound, comprising an RNA molecule that is between 15 and 35 bases in length having a 5′ end, a 3′ end and complementarity to a target, that binds to an intronic region of an mRNA encoding an sFLT1 protein, wherein the RNA molecule is fully chemically-stabilized and comprises a hydrophobic modification, wherein the therapeutic compound selectively reduces expression of the sFLT1 protein, and wherein the therapeutic compound reduces one or more symptoms of preeclampsia (PE), postpartum PE, eclampsia or Hemolysis/Elevated Liver enzymes/Low Platelet count (HELLP) syndrome when administered to a subject in need thereof.

9. The therapeutic compound of claim 8 , wherein
the sFLT1 protein is selected from the group consisting of one or any combination of sFLT1-i13 short, sFLT1-i13 long and sFlt1-i15a.

10. The therapeutic compound of claim 8 , comprising a first dsRNA comprising a first sense strand and a first antisense strand and a second dsRNA comprising a second sense strand and a second antisense strand, wherein the first antisense strand comprises a first region of complementarity which is substantially complementary to SEQ ID NO:1 and the second antisense strand comprises a second region of complementarity which is substantially complementary to SEQ ID NO:2.

11. The therapeutic compound of claim 8 , wherein the fully chemically stabilized RNA molecule comprises at least one modified nucleotide selected from the group consisting of a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative.

12. The first and second dsRNAs of claim 10 , wherein each dsRNA comprises a 5′ end, a 3′ end and complementarity to a target, wherein
the nucleotides are connected via phosphodiester or phosphorothioate linkages.

13. A method of treating one or more symptoms of PE, postpartum PE, eclampsia or HELLP syndrome in a subject in need thereof, comprising administering to the subject the therapeutic compound of claim 10 .

14. A method of treating one or more symptoms of an angiogenic disorder in a subject in need thereof, comprising administering to the subject the compound of claim 3 .

15. The method of claim 14 , wherein the angiogenic disorder is selected from the group consisting of PE, postpartum PE, eclampsia and HELLP syndrome.

16. The dsRNA of claim 7 , wherein the hydrophobic molecule comprises an omega-3 fatty acid.

17. The dsRNA of claim 16 , wherein the hydrophobic molecule is DHA or g2-DHA.

18. The compound of claim 3 , wherein the dsRNA mediates degradation of the mRNA.

19. The compound of claim 3 , wherein the dsRNA is blunt-ended.

20. The compound of claim 3 , wherein the dsRNA reduces expression of the sFLT1 protein in the cell or organism from about 30% to about 50%.

21. The compound of claim 2 , wherein the dsRNA molecule mediates degradation of the mRNA.

22. The compound of claim 2 , comprising a dsRNA having a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity which is substantially complementary to 5′ CATCATAGCTACCATTTATT 3′ (SEQ ID NO:2), or contains no more than 3 mismatches with SEQ ID NO: 2.

23. The compound of claim 2 , comprising a dsRNA having a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity which is substantially complementary to 5′ ATTGTACCACACAAAGTAAT 3′ (SEQ ID NO:3), or contains no more than 3 mismatches with SEQ ID NO: 3.

24. The compound of claim 2 , comprising a dsRNA having a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity which is substantially complementary to 5′ GAGCCAAGACAATCATAACA 3′ (SEQ ID NO:4), or contains no more than 3 mismatches with SEQ ID NO: 4.

25. The dsRNA of claim 22 , wherein said region of complementarity is complementary to at least 15 contiguous nucleotides of SEQ ID NO: 2.

26. The dsRNA of claim 23 , wher

Assignees

• Univ Massachusetts
• Beth Israel Deaconess Medical Ct Inc

Inventors

• Khvorova Anastasia
• Moore Melissa
• Turanov Anton A
• Karumanchi Ananth

Classifications

• C12N2310/14

  interfering nucleic acids [NA] · CPC title

• C12N15/1138 Primary

  against receptors or cell surface proteins · CPC title

• C12N2310/344

  Position-specific modifications, e.g. on every purine, at the 3'-end · CPC title

• C12N15/1137

  against enzymes (viral enzymes C12N15/1131; receptors C12N15/1138) · CPC title

• C12N2310/321

  2'-O-R Modification · CPC title