Compositions and methods for detecting human pegivirus 2 (HPgV-2)

Patent metadata

Field	Value
Publication number	US-10501816-B2
Application number	US-201815893120-A
Country	US
Kind code	B2
Filing date	Feb 9, 2018
Priority date	Jun 27, 2014
Publication date	Dec 10, 2019
Grant date	Dec 10, 2019

Abstract

Provided herein are compositions, methods, and kits for detecting human Pegivirus 2 (HPgV-2). In certain embodiments, provided herein are HPgV-2 specific nucleic acid probes and primers, and methods for detecting HPgV-2 nucleic acid. In other embodiments, provided herein are HPgV-2 immunogenic composition compositions, methods of treating a subject with immunogenic HPgV-2 peptides, and methods of detecting HPgV-2 subject antibodies in a sample.

First claim

We claim:

1. A composition comprising a synthetic DNA nucleic acid molecule,
wherein said synthetic DNA nucleic acid molecule comprises a nucleotide sequence at least 12 nucleotides in length that hybridizes under stringent conditions to a portion of an HPgV-2 genomic sequence selected from the group consisting of: the NS2 gene, the 5′ UTR, the S gene, the E1 gene, the E2 gene, the NS4a gene, the NS4b gene, and the 3′ UTR, and
wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO:1, 75, or 299-303.

2. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule comprises a detectable label.

3. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule hybridizes to said NS2 gene.

4. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule comprises at least one modified base.

5. The composition of claim 1 , further comprising a heterologous nucleic acid sequence, and wherein said synthetic nucleic acid molecule is linked to said heterologous nucleic acid sequence.

6. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule hybridizes to said S gene.

7. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule hybridizes to said E1 gene.

8. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule hybridizes to said E2 gene.

9. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule hybridizes to said NS4a gene.

10. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule comprises a primer that hybridizes to the NS2 gene of HPgV-2, wherein said primer comprises the nucleic acid sequence GTGGGACACCTCAACCCTGAAG (SEQ ID NO: 413).

11. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule comprises a primer that hybridizes to the 5′ UTR of HPgV-2, wherein said primer comprises the nucleic acid sequence CGCTGATCGTGCAAAGGGATG (SEQ ID NO: 416).

12. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule comprises a primer that hybridizes to the 5′ UTR of HPgV-2, wherein said primer comprises the nucleic acid sequence GCTCCACGGACGTCACACTGG (SEQ ID NO: 417).

13. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule comprises a labeled probe that hybridizes to the 5′ UTR of HPgV-2, wherein said probe comprises the nucleic acid sequence GCACCACTCCGTACAGCCTGAT (SEQ ID NO: 418).

14. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule hybridizes to said NS4b gene.

15. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule hybridizes to said 5′ UTR.

16. The composition of claim 1 , wherein said synthetic DNA nucleic acid molecule hybridizes to said 3′ UTR.

17. The composition of claim 1 , wherein said at synthetic DNA nucleic acid molecule is least 15 nucleotides in length.

18. The composition of claim 1 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO:303.

19. The composition of claim 1 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO:300.

20. The composition of claim 1 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO:301.

21. The composition of claim 1 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO:299.

22. The composition of claim 1 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO:302.

23. A composition comprising a synthetic nucleic acid molecule,
wherein said synthetic nucleic acid molecule comprises a nucleotide sequence at least 12 nucleotides in length that hybridizes under stringent conditions to a portion of an HPgV-2 genomic sequence selected from the group consisting of: the NS2 gene, the 5′ UTR, the S gene, the E1 gene, the E2 gene, the NS4a gene, the NS4b gene, and the 3′ UTR, and wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO: 1, 75, or 299-303;
wherein the synthetic nucleic acid molecule is linked to a fluorescent label, chemiluminescent label or enzymatic label, a heterologous nucleic acid sequence or a solid support or the synthetic nucleic acid molecule comprises at least one modified base selected from the group consisting of: phosphorothioate, boranophosphate, 4′-thio-ribose, locked nucleic acid, 2′-0-(2′-methoxyethyl), 2′-0-methyl, 2′-fluoro, 2′-deoxy-T-fluoro-b-D-arabinonucleic acid, phosphonoacetate, 2′-3′-seco-RNA, Morpholino nucleic acid analog, Peptide nucleic acid analog, phosphorodithioate, phosphoramidate, methylphosphonate, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxy-aminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, 2,6-diaminopurine, 2-aminopurine, 5-amino-allyluracil, 5-hydroxymethylcytosine, 5-iodouracil, 5-nitroindole, 5-propynylcytosine, 5-propynyluracil, hypoxanthine, N3-methyluracil, N6,N6-dimethyladenine, purine, C-5-propynyl cytosine, C-5-propynyl uracil, and difluorotouyl.

24. The composition of claim 23 , wherein said synthetic nucleic acid molecule hybridizes to said NS2 gene.

25. The composition of claim 23 , wherein said synthetic nucleic acid molecule hybridizes to said S gene.

26. The composition of claim 23 , wherein said synthetic nucleic acid molecule hybridizes to said E1 gene.

27. The composition of claim 23 , wherein said synthetic nucleic acid molecule hybridizes to said E2 gene.

28. The composition of claim 23 , wherein said synthetic nucleic acid molecule hybridizes to said NS4a gene.

29. The composition of claim 23 , wherein said synthetic nucleic acid molecule hybridizes to said NS4b gene.

30. The composition of claim 23 , wherein said synthetic nucleic acid molecule hybridizes to said 5′ UTR.

31. The composition of claim 23 , wherein said synthetic nucleic acid molecule hybridizes to said 3′ UTR.

32. The composition of claim 23 , wherein said synthetic nucleic acid molecule is at least 15 nucleotides in length.

33. The composition of claim 23 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO: 303.

34. The composition of claim 23 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO: 300.

35. The composition of claim 23 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO: 301.

36. The composition of claim 23 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO: 299.

37. The composition of claim 23 , wherein said genomic sequence of HPgV-2 is shown in SEQ ID NO: 302.

Assignees

• Abbott Lab
• Univ California

Inventors

• Chiu Charles
• Lee Deanna
• Berg Michael
• Dawson George
• Coller Kelly
• Cheng Kevin
• Hackett Jr John R
• Frankel Matthew
• Forberg Kenn

Classifications

• A61P31/14

  for RNA viruses · CPC title

• C12N2770/24021

  Viruses as such, e.g. new isolates, mutants or their genomic sequences · CPC title

• C12N2770/24034

  Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein · CPC title

• G01N33/56983

  Viruses · CPC title

• C12Q1/701 Primary

  Specific hybridization probes · CPC title