Antibiotic susceptibility testing using probes for preribosomal RNA

Patent metadata

Field	Value
Publication number	US-10370728-B2
Application number	US-201314398725-A
Country	US
Kind code	B2
Filing date	May 3, 2013
Priority date	May 4, 2012
Publication date	Aug 6, 2019
Grant date	Aug 6, 2019

Abstract

Described are probes and methods for detecting antibiotic susceptibility of a specimen. The method comprises contacting the specimen with an oligonucleotide probe that specifically hybridizes with a target nucleic acid sequence region of ribosomal RNA. The target sequence is at the junction between a pre-ribosomal RNA tail and mature ribosomal RNA of 23S or 16S rRNA. Performing the method in the presence and absence of an antibiotic permits detection of antibiotic susceptibility.

First claim

What is claimed is:

1. A device for detecting intact pre-rRNA in a bacterial sample, the device comprising a pair of oligonucleotide probes, at least one of which is immobilized on a solid support, wherein the pair of oligonucleotide probes comprises an oligonucleotide probe up to 50 nucleotides in length that includes SEQ ID NO: 5 and an oligonucleotide probe up to 50 nucleotides in length that includes SEQ ID NO: 6, and wherein the pair of oligonucleotide probes selectively hybridizes to a target sequence specific to intact pre-rRNA, wherein the target sequence comprises contiguous nucleotides of bacterial ribosomal RNA (rRNA) spanning a splice site between pre-ribosomal RNA (prRNA) tail and mature ribosomal RNA (mrRNA).

2. The device of claim 1 , wherein the bacterial rRNA is 23S rRNA.

3. The device of claim 1 , wherein the target sequence is:
(a)

(SEQ ID NO: 1)

AATGAACCGTGAGGCTTIAACCTTACAACGCCGAAGCTGTTTTGGCGG

ATTG;

(b)
(c)
(d)
wherein | indicates the splice site between prRNA and mRNA.

4. The device of claim 1 , wherein the oligonucleotide pair of probes is labeled with a detectable marker.

5. The device of claim 4 , wherein the marker is selected from the group consisting of fluorescent label, a radioactive label, a luminescent label, an enzyme, biotin, thiol or a dye.

6. The device of claim 1 , wherein the solid support is an electrode, membrane, ELISA well, or optical surface.

7. The device of claim 1 , wherein at least one of the oligonucleotide probes is modified to contain a phosphorothioate or 2′ 0-methyl linkage, a nontraditional base, and/or a modified form of adenine, cytidine, guanine, thymine, or uridine.

8. The device of claim 1 , wherein the pair of probes hybridizes to the target sequence under highly stringent conditions.

9. A method for determining whether a sample of bacteria is susceptible to an antibiotic agent, the method comprising the steps of:
(a) contacting a specimen obtained from the sample with the device of claim 1 in the absence of the agent;
(b) contacting a specimen obtained from the sample with the device in the presence of the antibiotic agent;
(c) detecting the relative amounts of probe hybridization to the target sequence in the specimens of (a) and (b);
(d) identifying the sample as susceptible to antibiotic treatment if the amount of probe hybridization to the target sequence in step (b) is reduced by at least 80% relative to the amount of probe hybridization to the target sequence in step (a).

10. The method of claim 9 , further comprising inoculating the specimen into a growth medium prior to the contacting of steps (a) and (b).

11. The method of claim 9 , wherein no pre-treatment of the specimen to deplete prRNA is performed prior to the contacting of steps (a) or (b).

12. The method of claim 1 , wherein the detecting comprises an optical, electrochemical or immunological assay.

13. The method of claim 12 , wherein the detecting comprises an electrochemical assay.

14. The method of claim 9 , further comprising lysing the bacteria under conditions that release rRNA from the bacteria prior to the contacting of steps (a) and (b).

15. The method of claim 9 , wherein the antibiotic agent is Chloramphenicol, aminoglycosides, quinolones, or beta-lactam antibiotics.

16. A method for determining the antibiotic efficacy of a candidate antibiotic agent, the method comprising the steps of:
(a) contacting a specimen obtained from the sample with the device of claim 1 in the absence of the agent;
(b) contacting a specimen obtained from the sample with the device in the presence of the agent;
(c) detecting the relative amounts of probe hybridization to the target sequence in the specimens of (a) and (b);
(d) identifying the agent as effective if the amount of probe hybridization to the target sequence in step (b) is reduced by at least 80% relative to the amount of probe hybridization to the target sequence in step (a).

17. A method for monitoring the growth rate of a bacterial culture, the method comprising the steps of:
(a) contacting a specimen obtained from the culture with the device of claim 1 ;
(b) detecting the amount of probe hybridization to the target sequence in the specimen of (a) relative to an earner time point:
(c) identifying the culture as growing if the amount of probe hybridization to the target sequence in step (b) is increased relative to the amount of probe hybridization to the target sequence at the earner time point.

Assignees

• Univ California
• The United States Of America Represented By The Dept Of Veterans Affairs

Inventors

• Haake David A
• Halford Colin
• Babbitt Jane T
• Churchill Bernard M

Classifications

• C12Q1/689 Primary

  for bacteria · CPC title

• C12Q2600/106

  Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism · CPC title