Purification process of nascent DNA

Patent metadata

Field	Value
Publication number	US-10131913-B2
Application number	US-201514681351-A
Country	US
Kind code	B2
Filing date	Apr 8, 2015
Priority date	Aug 31, 2009
Publication date	Nov 20, 2018
Grant date	Nov 20, 2018

Abstract

A method for initiating the replication of a deoxyribonucleic acid molecule includes inserting into the DNA at least one nucleic acid molecule representing a multicellular DNA replication origin. The replication origin contains at least nine nucleotides and contains at least three uninterrupted origin repeating elements (ORE), each ORE having the sequence N3GN4, wherein N3 is T or G and N4 is G or C. The method can confer autonomous replication properties to a non-self-replicating DNA molecule. A process for preparing a vector for use in said methods is also presented.

First claim

The invention claimed is:

1. A method for initiating the replication of a double stranded deoxyribonucleic acid (DNA) molecule in a pluricellular eukaryotic cell, said method comprising:
inserting into said DNA molecule at least one multicellular DNA replication origin, the replication origin comprising at least one of the following sequences:

GGGGGCGGGGAGGGAAGGGGG,
(SEQ ID NO: 32)

and

GGGGGATGGGGTTGGAATGGGGGCGGG;
(SEQ ID NO: 33)

introducing said DNA molecule comprising the inserted DNA replication origin into the pluricellular eukaryotic cell; and then
identifying the nascent DNA synthesized from the inserted DNA replication origin, the nascent DNA identifying the initiation of the replication, wherein replication of the DNA molecule comprising the DNA replication origin within the pluricellular eukaryotic cell is initiated by the presence of said replication origin.

2. The method according to claim 1 , wherein the G/C ratio in the at least one multicellular DNA replication origin is greater than 1.

3. A process for preparing a recombinant non-naturally occurring double stranded circular DNA vector comprising at least one multicellular DNA replication origin as the unique means for replicating the vector in a pluricellular eukaryotic cell or cell extract, said process comprising:
inserting into a vector at least one multicellular DNA replication origin, the replication origin comprising at least one of the following sequences:

GGGGGCGGGGAGGGAAGGGGG,
(SEQ ID NO: 32)

and

GGGGGATGGGGTTGGAATGGGGGCGGG;
(SEQ ID NO: 33)

introducing said DNA molecule comprising the inserted DNA replication origin into the pluricellular eukaryotic cell; and then
recovering the replicated vectors;
wherein the inserted at least one multicellular DNA replication origin is originated from a nucleic acid molecule, the nucleic acid molecule being absent in the vector before its insertion, and
wherein the inserted at least one multicellular DNA replication origin allows said DNA vector to self-replicate in a pluricellular eukaryotic cell or cell extract.

4. The method according to claim 3 , wherein the G/C ratio in the at least one multicellular DNA replication origin is greater than 1.

Assignees

• Centre Nat Rech Scient
• Centre Nat Rech Scient

Inventors

• Mechali Marcel
• Coulombe Philippe
• Cayrou Christelle
• Rivals Eric
• Prorok Paulina

Classifications

• C12N15/69

  Increasing the copy number of the vector · CPC title

• C12N15/64 Primary

  General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host · CPC title