Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

Patent metadata

Field	Value
Publication number	US-10113167-B2
Application number	US-201615138604-A
Country	US
Kind code	B2
Filing date	Apr 26, 2016
Priority date	May 25, 2012
Publication date	Oct 30, 2018
Grant date	Oct 30, 2018

Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

First claim

What is claimed is:

1. A non-naturally occurring DNA-targeting RNA, or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises:
(a) a targeter-RNA comprising:
(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and
(ii) a second nucleotide sequence that hybridizes with an activator-RNA,
wherein the first and second nucleotide sequences are heterologous to one another; and

(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.

2. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 10 to 15 base pairs.

3. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 10 base pairs.

4. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein (a) and (b) are not covalently linked to one another by intervening nucleotides.

5. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 15 nucleotides (nt) to 18 nt long.

6. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 18 nucleotides (nt) to 25 nt long.

7. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the target DNA molecule is chromosomal DNA.

8. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).

9. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU (SEQ ID NO: 432).

10. The non-naturally occurring DNA-targeting RNA of claim 1 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA is conjugated to a heterologous moiety.

11. The non-naturally occurring DNA-targeting RNA of claim 10 , or the nucleic acid encoding said non-naturally occurring DNA-targeting RNA, wherein the heterologous moiety is an intercalator, a reporter molecule, a polyamine, a polyamide, a polyethylene glycol, a polyether, a cholesterol, a lipid, a cholic acid, a thioether, a thiocholesterol, an aliphatic chain, a phospholipid, an adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety, a biotin, a phenazine, a folate, a phenanthridine, an anthraquinone, an acridine, a fluorescein, a rhodamine, a fluor, a coumarin, a dye, or a protein transduction domain.

12. A non-naturally occurring DNA-targeting RNA that comprises:
(a) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA molecule, and
(b) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA (dsRNA) duplex of a protein-binding segment, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the non-naturally occurring DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase, and
wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with a Cas9 polypeptide and targeting the complex to the target sequence of the target DNA molecule.

13. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising a non-natural internucleoside linkage that comprises one or more of: a phosphorothioate, a phosphoramidate, a non-phosphodiester, a heteroatom, a chiral phosphorothioate, a phosphorodithioate, a phosphotriester, an aminoalkylphosphotriester, a 3′-alkylene phosphonates, a 5′-alkylene phosphonate, a chiral phosphonate, a phosphinate, a 3′-amino phosphoramidate, an aminoalkylphosphoramidate, a phosphorodiamidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a selenophosphate, and a boranophosphate.

14. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising one or more of: (i) a non-natural internucleoside linkage that is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); and (iii) a modified sugar moiety that is 2′-O methoxyethyl, 2′-O-methyl, or 2′-fluoro.

15. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising one or more peptide nucleic acids (PNAs), morpholino nucleic acids, cyclohexenyl nucleic acids (CeNAs), and/or locked nucleic acids (LNAs).

16. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising one or more of: a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a 2′-O-methyl modified sugar moiety, and a 2′-fluoro modified sugar moiety.

17. The non-naturally occurring DNA-targeting RNA of claim 12 , comprising a nucleobase comprising one or more of: a 5-methylcytosine; a 5-hydroxymethyl cytosine; a xanthine; a hypoxanthine; a 2-aminoadenine; a 6-methyl derivative of adenine; a 6-methyl derivative of guanine; a 2-propyl derivative of adenine; a 2-propyl derivative of guanine; a 2-thiouracil; a 2-thiothymine; a 2-thiocytosine; a 5-halouracil; a 5-halocytosine; a 5-propynyl uracil; a 5-propynyl cytosine; a 6-azo uracil; a 6-azo cytosine; a 6-azo thymine; a pseudouracil; a 4-thiouracil; an 8-halo; an 8-amino; an 8-thiol; an 8-thioalkyl; an 8-hydroxyl; a 5-halo; a 5-bromo; a 5-trifluoromethyl; a 5-substituted uracil; a 5-substituted cytosine; a 7-methylguanine; a 7-methyladenine; a 2-F-adenine; a 2-amino-adenine; all 8-azaguanine; an 8-azaadenine; a 7-deazaguanine; a 7-deazaadenine; a 3-deazaguanine; a 3-deazaadenine; a tricyclic pyrimidine; a phenoxazine cytidine; a phenothiazine cytidine; a substituted phenoxazine cytidine; a carbazole cytidine; a pyridoindole cytidine; a 7-deaza-adenine; a 7-deazaguanosine; a 2-aminopyridine; a 2-pyridone; a 5-substituted pyrimidine; a 6-azapyrimidine; an N-2, N-6or O-6 substituted purine; a 2-aminopropyladenine; a 5-propynyluracil; and a 5-propynylcytosine.

18. The non-naturally occurring DNA-targeting RNA of claim 12 , wherein (a) and (b) ar

Assignees

• Univ California
• Univ Vienna
• Charpentier Emmanuelle

Inventors

• Doudna Jennifer A
• Jinek Martin
• Chylinski Krzysztof
• Charpentier Emmanuelle

Classifications

• H10P14/6512

  by exposure to a gas or vapour · CPC title

• H10P14/20

  of semiconductor materials · CPC title

• A61P43/00

  Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title

• A61P31/04

  Antibacterial agents · CPC title

• A61P35/00

  Antineoplastic agents · CPC title