Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure

Patent metadata

Field	Value
Publication number	US-10100304-B2
Application number	US-201213550210-A
Country	US
Kind code	B2
Filing date	Jul 16, 2012
Priority date	Mar 21, 2003
Publication date	Oct 16, 2018
Grant date	Oct 16, 2018

Abstract

The invention provides a method for generating an oligonucleotide with which an exon may be skipped in a pre-mRNA and thus excluded from a produced mRNA thereof. Further provided are methods for altering the secondary structure of an mRNA to interfere with splicing processes and uses of the oligonucleotides and methods in the treatment of disease. Further provided are pharmaceutical compositions and methods and means for inducing skipping of several exons in a pre-mRNA.

First claim

What is claimed is:

1. An antisense oligonucleotide of 15 to 24 nucleotides in length, comprising at least 15 consecutive bases of a base sequence of the sequence UCAAGGAAGAUGGCAUUUCU (SEQ ID NO: 27), wherein the antisense oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA, and wherein the antisense oligonucleotide comprises a modification.

2. The oligonucleotide of claim 1 , wherein the modification is a morpholine ring.

3. The oligonucleotide of claim 1 , wherein the modification is a phosphorodiamidate internucleoside linkage.

4. The oligonucleotide of claim 1 , wherein the modification is a peptide nucleic acid and/or locked nucleic acid.

5. The oligonucleotide of claim 3 , wherein each linkage is a phosphorodiamidate internucleoside linkage.

6. The oligonucleotide of claim 1 , wherein the oligonucleotide is a morpholino phosphorodiamidate oligonucleotide.

7. The oligonucleotide of claim 1 , wherein the modification is a 2′-O-methyl ribose moiety.

8. The oligonucleotide of claim 1 , wherein the modification is a phosphorothioate internucleoside linkage.

9. The oligonucleotide of claim 8 , wherein each internucleoside linkage is a phosphorothioate linkage.

10. The oligonucleotide of claim 7 , wherein said oligonucleotide is a 2′-O-methyl phosphorothioate oligonucleotide.

11. The oligonucleotide of claim 1 , wherein the oligonucleotide induces exon 51 skipping in the human dystrophin pre-mRNA and dystrophin expression in the muscle cell upon transfection of human muscle cells with at least 100 nM of said oligonucleotide and incubation for at least 16 hours.

12. The antisense oligonucleotide of claim 11 , wherein exon 51 skipping is detected by RT-PCR and/or sequence analysis.

13. The oligonucleotide of claim 11 , wherein dystrophin expression in the muscle cell is detected by immunohistochemical and/or western blot analysis.

14. The oligonucleotide of claim 1 , wherein the modification confers increased resistance to RNAseH.

Assignees

• Van Deutekom Judith Christina Theodora
• Academisch Ziekenhuis Leiden

Inventors

• Van Deutekom Judith Christina Theodora

Classifications

• A61P43/00

  Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00 · CPC title

• A61P21/04

  for myasthenia gravis · CPC title

• A61P21/00

  Drugs for disorders of the muscular or neuromuscular system · CPC title

• C12N2310/315

  Phosphorothioates · CPC title

• C12N2310/3233

  Morpholino-type ring · CPC title